BBa_K176043 1 VR9 bindin Reverse primer VR9 (K176053) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR9 (K176053). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. false Jiayi Dou, Hao Jiang annotation2017247 1 VR9 range2017247 1 1 20 BBa_K176008 1 pCon 0.15 constitutive promoter family member J23115 actual sequence (pCon 0.15) 2009-06-16T11:00:00Z 2015-05-08T01:11:01Z J23115 Released HQ 2013 The sequence of J23115 is wrong according to sequencing result of the registry and ours. This part K176008 is created for the actual promoter. http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=3647 http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=1209 J23115: tttatagctagctcagCcctTggtacaatgctagc K176008: tttatagctagctcagTcctAggtacaatgctagc false true _282_ 0 3908 9 In stock true This is the actual sequence of J23115. false Hao Jiang, Danqian Liu, Chao Li annotation2005561 1 c in J23115 range2005561 1 17 17 annotation2005560 1 -10 range2005560 1 24 29 annotation2005563 1 NheI range2005563 1 7 12 annotation2005564 1 NheI range2005564 1 30 35 annotation2005565 1 AvrII range2005565 1 18 23 annotation2005562 1 t in J23115 range2005562 1 21 21 annotation2005559 1 -35 range2005559 1 1 6 BBa_K176103 1 BBa_K176103 constitutive promoter family member K176008 (pCon 0.15) with primer VR9 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176043 K176008 VR9 binding site + pCon 0.15 false false _282_ 0 3908 9 It's complicated true VR9 binding site + pCon 0.15 false Jiayi Dou, Hao Jiang component2018799 1 BBa_K176008 component2018791 1 BBa_K176043 annotation2018791 1 BBa_K176043 range2018791 1 1 20 annotation2018799 1 BBa_K176008 range2018799 1 29 63 BBa_K176103_sequence 1 gatgaggctacgtgctttcttactagagtttatagctagctcagtcctaggtacaatgctagc BBa_K176043_sequence 1 gatgaggctacgtgctttct BBa_K176008_sequence 1 tttatagctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z