BBa_J23109 1 BBa_J23109 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K176042 1 VR8 bindin Reverse primer VR8 (K176052) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR8 (K176052). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. false Jiayi Dou, Hao Jiang annotation2017246 1 VR8 range2017246 1 1 20 BBa_K176104 1 BBa_K176104 constitutive promoter family member J23109 (pCon 0.04) with primer VR8 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176042 J23109 VR8 binding site + pCon 0.04 false false _282_ 0 3908 9 It's complicated true VR8 binding site + pCon 0.04 false Jiayi Dou, Hao Jiang component2018801 1 BBa_K176042 component2018802 1 BBa_J23109 annotation2018802 1 BBa_J23109 range2018802 1 29 63 annotation2018801 1 BBa_K176042 range2018801 1 1 20 BBa_J23109_sequence 1 tttacagctagctcagtcctagggactgtgctagc BBa_K176042_sequence 1 catcaatttcacaggcgctc BBa_K176104_sequence 1 catcaatttcacaggcgctctactagagtttacagctagctcagtcctagggactgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z