##gff-version 3
##sequence-region BBa_K176164 1 668
BBa_K176164	.	terminator	628	668	.	+	0	ID=BBa_B0012;Name=BBa_B0012
BBa_K176164	.	engineered_region	628	668	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_K176164	.	stop_codon	661	661	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_K176164	.	stem_loop	635	654	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_K176164	.	polyA_site	655	668	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_K176164	.	CDS	19	531	.	+	0	ID=BBa_K176158;Name=BBa_K176158
BBa_K176164	.	point_mutation	183	183	.	+	0	ID=annotation2020923;Name=g and 69bp in I732006;Parent=BBa_K176158
BBa_K176164	.	CDS	19	492	.	+	0	ID=annotation2020913;Name=lacZalpha-ccdB;Parent=BBa_K176158
BBa_K176164	.	point_mutation	273	273	.	+	0	ID=annotation2020927;Name=c in K145151;Parent=BBa_K176158
BBa_K176164	.	start_codon	19	21	.	+	0	ID=annotation2020918;Name=Start;Parent=BBa_K176158
BBa_K176164	.	tag	493	525	.	+	0	ID=annotation2020914;Name=LVA degradation tag (AANDENYALVA);Parent=BBa_K176158
BBa_K176164	.	sequence_alteration	34	34	.	+	0	ID=annotation2020919;Name=177bp and a in J32026;Parent=BBa_K176158
BBa_K176164	.	primer_binding_site	59	82	.	+	0	ID=annotation2020921;Name=M13 -47 primer (K176059);Parent=BBa_K176158
BBa_K176164	.	stop_codon	526	531	.	+	0	ID=annotation2020916;Name=Stop;Parent=BBa_K176158
BBa_K176164	.	engineered_region	190	492	.	+	0	ID=annotation2020925;Name=ccdB (K145151);Parent=BBa_K176158
BBa_K176164	.	primer_binding_site	206	233	.	+	0	ID=annotation2020926;Name=VRccdB primer (K176058);Parent=BBa_K176158
BBa_K176164	.	primer_binding_site	59	75	.	+	0	ID=annotation2020922;Name=M13 -40 primer;Parent=BBa_K176158
BBa_K176164	.	primer_binding_site	39	55	.	+	0	ID=annotation2020920;Name=M13 -20 primer;Parent=BBa_K176158
BBa_K176164	.	engineered_region	19	183	.	+	0	ID=annotation2020917;Name=a part of lacZalpha (I732006);Parent=BBa_K176158
BBa_K176164	.	sequence_alteration	190	191	.	+	0	ID=annotation2020924;Name=at in K145151;Parent=BBa_K176158
BBa_K176164	.	ribosome_entry_site	1	12	.	+	0	ID=BBa_B0034;Name=BBa_B0034
BBa_K176164	.	conserved_region	5	8	.	+	0	ID=annotation23325;Name=conserved;Parent=BBa_B0034
BBa_K176164	.	terminator	540	619	.	+	0	ID=BBa_B0010;Name=BBa_B0010
BBa_K176164	.	engineered_region	540	619	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_K176164	.	stem_loop	551	594	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
>BBa_K176164
aaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctg
gcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcg
cccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctg
tttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgt
cagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggc
cagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaac
ctgatgttctggggaatagctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaata
aaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcaca
ctggctcaccttcgggtgggcctttctgcgtttata