BBa_K176157 1 ccdB-LVA ccdB-LVA coding sequence 2009-09-13T11:00:00Z 2015-07-09T11:35:55Z PCR from K145151. Forward Primer: VF2(G00100) Reverse Primer: GTTT ACTAGT A TTATTA AGC TAC TAA AGC GTA GTT TTC GTC GTT TGC AGC tattccccagaacatcaggtta Digest with EcoRI and SpeI, ligate into pSB1A3. Add LVA degradation tag (widely used in C0040, C0051, C0061...) to ccdB(K145151) C-terminal: [K145151 without stop codon] GCT GCA AAC GAC GAA AAC TAC GCT TTA GTA GCT [TAA TAA] A A N D E N Y A L V A true false _282_ 4206 3908 9 It's complicated true Add LVA degradation tag (widely used in C0040, C0051, C0061...) to ccdB(K145151) C-terminal: [K145151 without stop codon] GCT GCA AAC GAC GAA AAC TAC GCT TTA GTA GCT [TAA TAA] A A N D E N Y A L V A false Danqian Liu, Zongxiao He, Hao Jiang annotation2020911 1 Stop range2020911 1 337 342 annotation2020910 1 Start range2020910 1 1 3 annotation2020912 1 VRccdB primer (K176058) range2020912 1 17 44 annotation2020908 1 ccdB (K145151) range2020908 1 1 303 annotation2020909 1 LVA degradation tag (AANDENYALVA) range2020909 1 304 336 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K176165 1 BBa_K176165 PoPS->RBS(weak)+ccdB-LVA+T 2009-09-21T11:00:00Z 2015-05-08T01:11:03Z K176151 B0015 Generate ccdB-LVA (weak RBS) false false _282_ 0 3908 9 Not in stock false weak RBS + ccdB-LVA coding + strong terminator false Danqian Liu, Zongxiao He, Hao Jiang component2026637 1 BBa_B0031 component2026644 1 BBa_B0010 component2026643 1 BBa_K176157 component2026646 1 BBa_B0012 annotation2026644 1 BBa_B0010 range2026644 1 371 450 annotation2026643 1 BBa_K176157 range2026643 1 21 362 annotation2026646 1 BBa_B0012 range2026646 1 459 499 annotation2026637 1 BBa_B0031 range2026637 1 1 14 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K176157_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatagctgcaaacgacgaaaactacgctttagtagcttaataa BBa_K176165_sequence 1 tcacacaggaaacctactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatagctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0031_sequence 1 tcacacaggaaacc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z