BBa_K176190 1 AID Activation-Induced (Cytidine) Deaminase (standard version of K103001) 2009-10-09T11:00:00Z 2015-05-08T01:11:04Z PCR from [[Part:BBa_K103001|K103001]]. Forward Primer: GTTTC T TCTAGa tg gacagcctcttgatgaacc Reverse Primer: GTTTC CTGCA G CGGCCGC T ACTAGT A TTATTa aagtcccaaagtacgaaatg Digest with XbaI and PstI, ligate into pSB1A3. AID is an enzyme which can increase mutation rate in vivo by C->U conversion on DNA. [[Part:BBa_K103001|K103001]] is the coding sequence of AID with NcoI site before start codon. This part K176190 is a standard AID coding sequence starts with ATG and ends with TAATAA. Reference for Biology and Usage: http://en.wikipedia.org/wiki/Activation-Induced_%28Cytidine%29_Deaminase http://2009.igem.org/Team:USTC http://2008.igem.org/Team:Warsaw http://2008.igem.org/Team:Peking_University http://www.ccbi.cam.ac.uk/iGEM2007/index.php/Gamma_-_automatic_directed_evolution false false _282_ 0 3908 9 It's complicated true Standard AID coding sequence starts with ATG and ends with TAATAA. false Danqian Liu, Zongxiao He, Hao Jiang annotation2032940 1 Stop range2032940 1 595 600 annotation2032941 1 Activation-Induced (Cytidine) Deaminase range2032941 1 1 594 annotation2032939 1 Start range2032939 1 1 3 BBa_K176190_sequence 1 atggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z