BBa_K176190 1 AID Activation-Induced (Cytidine) Deaminase (standard version of K103001) 2009-10-09T11:00:00Z 2015-05-08T01:11:04Z PCR from [[Part:BBa_K103001|K103001]]. Forward Primer: GTTTC T TCTAGa tg gacagcctcttgatgaacc Reverse Primer: GTTTC CTGCA G CGGCCGC T ACTAGT A TTATTa aagtcccaaagtacgaaatg Digest with XbaI and PstI, ligate into pSB1A3. AID is an enzyme which can increase mutation rate in vivo by C->U conversion on DNA. [[Part:BBa_K103001|K103001]] is the coding sequence of AID with NcoI site before start codon. This part K176190 is a standard AID coding sequence starts with ATG and ends with TAATAA. Reference for Biology and Usage: http://en.wikipedia.org/wiki/Activation-Induced_%28Cytidine%29_Deaminase http://2009.igem.org/Team:USTC http://2008.igem.org/Team:Warsaw http://2008.igem.org/Team:Peking_University http://www.ccbi.cam.ac.uk/iGEM2007/index.php/Gamma_-_automatic_directed_evolution false false _282_ 0 3908 9 It's complicated true Standard AID coding sequence starts with ATG and ends with TAATAA. false Danqian Liu, Zongxiao He, Hao Jiang annotation2032941 1 Activation-Induced (Cytidine) Deaminase range2032941 1 1 594 annotation2032940 1 Stop range2032940 1 595 600 annotation2032939 1 Start range2032939 1 1 3 BBa_K176191 1 BBa_K176191 PoPS->RBS(weak)+AID->PoPS 2009-10-09T11:00:00Z 2015-05-08T01:11:04Z B0031 K176190 Weak RBS(B0031) + Activation-Induced (Cytidine) Deaminase coding sequence false false _282_ 0 3908 9 It's complicated false Weak RBS(B0031) + Activation-Induced (Cytidine) Deaminase coding sequence false Danqian Liu, Zongxiao He, Hao Jiang component2032943 1 BBa_B0031 component2032947 1 BBa_K176190 annotation2032943 1 BBa_B0031 range2032943 1 1 14 annotation2032947 1 BBa_K176190 range2032947 1 21 620 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_K176191_sequence 1 tcacacaggaaacctactagatggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_K176190_sequence 1 atggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z