BBa_K1763004 1 BBa_K1763004 Major Spidroin Protein 2 (MaSp2) with sticky ends CA 2015-06-01T11:00:00Z 2015-09-18T10:53:36Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This part contains the core sequence of MaSp2 that has been assembled with a 5'-CGTG-3' overhang on the 5' end of the sequence and 3'-TCAA-5' overhang on the 3' end of the sequence. This part was designed for use with ICA, along with parts BBa_K1763003 and BBa_K1763004 as an efficient method to assemble multiple MaSp2 sequences together. This setup is to show that this particular set of sticky ends is suitable for ICA. Before using in ICA, this part should be digested with BsaI, a type IIs restriction enzyme, which cuts DNA outside of its recognition site. false false _2185_ 27136 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2432569 1 BsaI recognition site (forward) range2432569 1 1 5 annotation2432570 1 BsaI recognition site (reverse) range2432570 1 114 119 annotation2463765 1 A sticky end range2463765 1 109 112 annotation2463764 1 C sticky end range2463764 1 7 10 annotation2473129 1 MaSp2 Core range2473129 1 10 108 BBa_K1763004_sequence 1 gtctcacgtgggaggctatggacctggtcagcaaggtccaggaggatatggaccaggacaacaaggaccatcaggaccaggatcagcagcagcagcagccgcagccgcagtttgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z