BBa_K1763009 1 BBa_K1763009 Major Spidroin Protein 2 (MaSp2) Sequencing Core with AB Sticky Ends 2015-07-26T11:00:00Z 2015-09-16T10:43:11Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This part contains the core sequence of MaSp2 that has been assembled with a 5'-AGTT-3' overhang on the 5' end of the sequence and 3'-ACAG-5' overhang on the 3' end of the sequence. This part was designed for use with ICA, along with parts BBa_K1763003 and BBa_K1763004 as an efficient method to assemble multiple MaSp2 sequences together. This setup is to show that this particular set of sticky ends is suitable for ICA. Before using in ICA, this part should be digested with BsaI, a type IIs restriction enzyme, which cuts DNA outside of its recognition site. This part codes for identical protein primary sequence as BBa_K17630002, but has a different DNA sequence. This part is intended to anneal to a sequencing primer that will allow longer composite MaSp genes to be read. false false _2185_ 27136 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2473347 1 SeqF Primer Binding Site range2473347 1 47 64 annotation2454683 1 BsaI recognition site(reverse) range2454683 1 114 119 annotation2463770 1 A sticky end range2463770 1 7 10 annotation2433551 1 BsaI recognition site (forward) range2433551 1 1 5 annotation2473130 1 MaSp2 Core Sequence range2473130 1 10 108 annotation2473348 1 SeqR Primer Binding Site range2473348 1 47 64 annotation2463771 1 B sticky end range2463771 1 109 112 BBa_K1763009_sequence 1 gtctcaagttggaggctatggacctggtcagcaaggtccaggaggatacggtcctggtcaacagggaccatcaggaccaggatcagcagcagcagcagccgcagctgctgtcggagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z