BBa_K1763010 1 BBa_K1763010 Major Spidroin Protein 1 (MaSp1) with Sticky Ends AB 2015-07-26T11:00:00Z 2015-09-16T10:43:37Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This part contains the core sequence of MaSp1 that has been assembled with a 5'-AGTT-3' overhang on the 5' end of the sequence and 3'-ACAG-5' overhang on the 3' end of the sequence. This part was designed for use with ICA, along with parts BBa_K1763003 and BBa_K1763004 as an efficient method to assemble multiple MaSp sequences together. This setup is to show that this particular set of sticky ends is suitable for ICA. Before using in ICA, this part should be digested with BsaI, a type IIs restriction enzyme, which cuts DNA outside of its recognition site. false false _2185_ 27136 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2433552 1 BsaI recognition site (forward) range2433552 1 1 5 annotation2463772 1 A sticky end range2463772 1 7 10 annotation2433553 1 BsaI recognition site (reverse) range2433553 1 114 119 annotation2473356 1 MaSp1 Core range2473356 1 10 108 annotation2463773 1 B sticky end range2463773 1 109 112 BBa_K1763010_sequence 1 gtctcaagttggaggagcaggacaaggaggatacggcggattaggatcacaaggagcaggaagaggtggactaggaggacaaggagctggagcagcagcagccgctgctgtctgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z