BBa_K1763013 1 BBa_K1763013 M2-3(1C3) 2015-07-26T11:00:00Z 2015-09-16T03:23:17Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This a gene sequence consisting of three MaSp2 pieces assembled together into the pSB1C3 vector using Iterative Capped Assembly. This part does not have any regulatory sites, and is intended to be cloned into an expression vector. true false _2185_ 22156 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2433559 1 M2-AB range2433559 1 36 137 annotation2433558 1 8-his tag range2433558 1 3 27 annotation2433561 1 M2-CA range2433561 1 240 341 annotation2433560 1 M2-BC range2433560 1 138 239 BBa_K1763013_sequence 1 atgcatcatcaccatcaccaccatcataagcttgcagttggaggctatggacctggtcagcaaggtccaggaggatatggaccaggacaacaaggaccatcaggaccaggatcagcagcagcagcagccgcagctgctgtcggaggctatggacctggtcagcaaggtccaggaggatatggaccaggacaacaaggaccatcaggaccaggatcagcagcagcagcagccgcagctgccgtgggaggctatggacctggtcagcaaggtccaggaggatatggaccaggacaacaaggaccatcaggaccaggatcagcagcagcagcagccgcagccgcagttggatcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z