BBa_K1763423 1 BBa_K1763423 MaSp1-SeqAB2 2015-09-14T11:00:00Z 2016-02-10T11:27:38Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This part contains the core sequence of MaSp2 that has been assembled with a 5'-AGTT-3' overhang on the 5' end of the sequence and 3'-ACAG-5' overhang on the 3' end of the sequence. This part was designed for use with ICA, along with parts BBa_K1763003 and BBa_K1763004 as an efficient method to assemble multiple MaSp2 sequences together. This setup is to show that this particular set of sticky ends is suitable for ICA. Before using in ICA, this part should be digested with BsaI, a type IIs restriction enzyme, which cuts DNA outside of its recognition site. Sequence and Features false false _2185_ 4206 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2473474 1 MaSp1 SeqR Primer range2473474 1 41 58 annotation2463790 1 BsaI recognition site (reverse) range2463790 1 114 119 annotation2473473 1 MaSp1 SeqF Primer range2473473 1 41 58 annotation2463793 1 B sticky end range2463793 1 109 112 annotation2463789 1 BsaI recognition site (forward) range2463789 1 1 5 annotation2473472 1 MaSp1 Core Sequence range2473472 1 11 108 annotation2463791 1 A sticky end range2463791 1 7 10 BBa_K1763423_sequence 1 gtctcaagttggaggagcaggacaaggaggatacggcggactaggatctcagggagcaggaagaggaggactaggaggacaaggagctggagcagcagcagccgctgctgtctgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z