BBa_K1766000 1 MicF MicF non-coding regulatory RNA 2015-08-25T11:00:00Z 2015-09-16T11:12:44Z BBa_K1766000 is based on the micF gene found in Escherichia coli. The BioBrick??? was created from a gBlocks?? gene fragment synthesized by Integrated DNA Technologies. MicF is a non-coding RNA which regulates expression of the ompF (outer membrane porin F) gene in E. coli. MicF binds to the 5??? untranslated region of ompF mRNA, to prevent translation and promote degradation. MicF can be used together with BBa_K176601 to regulate protein expression. false false _2188_ 25546 25546 9 false The transcribed MicF only consists of the last 93 nt of BBa_K1766000. The preceding region was added in consideration of the genomic sequence. false Sarah Wideman annotation2438244 1 MicF range2438244 1 147 239 BBa_K1766000_sequence 1 actttttaagattattgcggaatggcgaaataagcacctaacatcaagcaataataattcaaggttaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z