BBa_R0082 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompC. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes the three OmpR binding sites: C1, C2, and C3. The promoter starts at -107 and goes up to the transcriptional start site at +1. An alternate version, BBa_R0083, cuts out the C2 and C3 sites. The efficacy of this promoter versus the truncated ompC upstream region (BBa_R0083) or the ompF upstream region (BBa_R0084) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301156 1 C3 OmpR range301156 1 54 71 annotation301167 1 -10 range301167 1 98 103 annotation301166 1 -35 range301166 1 75 80 annotation301154 1 C1 OmpR range301154 1 13 30 annotation301155 1 C2 OmpR range301155 1 34 51 BBa_K1766003 1 BBa_K1766003 OmpR controlled MicF 2015-09-05T11:00:00Z 2015-09-06T04:33:57Z e. coli long description false false _2188_ 25546 25546 9 false design false Sarah Wideman component2445292 1 BBa_R0082 component2445294 1 BBa_K1766000 annotation2445292 1 BBa_R0082 range2445292 1 1 108 annotation2445294 1 BBa_K1766000 range2445294 1 117 355 BBa_K1766000 1 MicF MicF non-coding regulatory RNA 2015-08-25T11:00:00Z 2015-09-16T11:12:44Z BBa_K1766000 is based on the micF gene found in Escherichia coli. The BioBrick??? was created from a gBlocks?? gene fragment synthesized by Integrated DNA Technologies. MicF is a non-coding RNA which regulates expression of the ompF (outer membrane porin F) gene in E. coli. MicF binds to the 5??? untranslated region of ompF mRNA, to prevent translation and promote degradation. MicF can be used together with BBa_K176601 to regulate protein expression. false false _2188_ 25546 25546 9 false The transcribed MicF only consists of the last 93 nt of BBa_K1766000. The preceding region was added in consideration of the genomic sequence. false Sarah Wideman annotation2438244 1 MicF range2438244 1 147 239 BBa_R0082_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggact BBa_K1766000_sequence 1 actttttaagattattgcggaatggcgaaataagcacctaacatcaagcaataataattcaaggttaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggtttttttt BBa_K1766003_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttactagagactttttaagattattgcggaatggcgaaataagcacctaacatcaagcaataataattcaaggttaaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z