BBa_K1768001 1 BBa_K1768001 Recombinase invertible constitutive promoter 1 2015-09-11T11:00:00Z 2015-09-18T06:29:26Z Lox66: BBa_I718016 Lox71: BBa_J23100 Constitutive promoter: BBa_J23100 A constitutive promoter flanked by Lox71 and Lox66 which is recognised by the Cre enzyme which initiates a single round of recombination between these sites. Thus the direction of the promoter is changed allowing expression of a different gene. false false _2190_ 26979 26979 9 false Lox71 is reserved relative to Lox66. false Gert Pietersen BBa_K1768001_sequence 1 ataacttggtatagcatacattatacgaacggtactgggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgctagcactgtacctaggactgagctagccgtcaagtcagccagtttagtctgaccatctcatctgtaacaacattggcaacgctacctttgccatgtttcagaaacaactctggtattgaagcatattacatacgatatgcttgccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z