BBa_K1768003 1 BBa_K1768003 Recombinase invertible constitutive promoter 2 2015-09-13T11:00:00Z 2015-09-14T01:57:21Z Lox66: BBa_I718016 Lox71: BBa_J23100 Constitutive promoter: BBa_J23100 A reverse compliment of a constitutive promoter flanked by Lox71 and Lox66 which are recognised by the Cre enzyme and facilitates a single round of recombination between these sites. Thus the direction of the promoter can be changed allowing expression of a different gene than in the initial state. This part is the same as part BBa_K1768001 but Lox71 is upstream of the promoter with a downstream lox66. false false _2190_ 26979 26979 9 false Lox71 is reversed relative to Lox66. Spacer sequence from non-coding pUC19 are added between Lox sites. false Gert Pietersen BBa_K1768003_sequence 1 taccgttcgtatagcatacattatacgaagttatctgggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgctagcactgtacctaggactgagctagccgtcaagtcagccagtttagtctgaccatctcatctgtaacaacattggcaacgctacctttgccatgtttcagaaacaactctggatggcaagcatattacatacgatatggttcaata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z