BBa_K1769000 1 2 x FYVE Dimeric FYVE 2015-09-13T11:00:00Z 2015-09-18T01:21:33Z This part come from Hrs gene from mouse Dimeric Hrs FYVE is a small binding molecule that can bind to phosphatidylinositol 3-phosphate (PtdIns(3)P), a receptor that exists on endosome. Since it is more stable then monomeric FYVE, it is widely used to recognize and locate PtdIns(3)P. false false _2191_ 25576 25576 9 false The linker region with 6 amino acid between two FYVE protein domain works better false Ho-Tsang Tsai annotation2455420 1 linker region range2455420 1 205 255 annotation2455418 1 start codon range2455418 1 1 3 annotation2455419 1 FYVE domain range2455419 1 1 204 annotation2455421 1 FYVE domain range2455421 1 256 426 BBa_K1769000_sequence 1 atgttcgctgctgaaagagcccctgactgggtggatgctgaggaatgccatcggtgcagagtacagtttggggtggtgacccgcaagcatcactgccgagcatgtgggcagatcttctgtggcaagtgctcctccaagtactccaccatccccaagttcggcattgagaaggaggtgcgcgtgtgtgagccctgctatgagcagactagacaaggatcaatgttcgctgctgaaagagcccctgactgggtggatgctgaggaatgccatcggtgcagagtacagtttggggtggtgacccgcaagcatcactgccgagcatgtgggcagatcttctgtggcaagtgctcctccaagtactccaccatccccaagttcggcattgagaaggaggtgcgcgtgtgtgagccctgctatgagcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z