BBa_K1769004 1 BBa_K1769004 Monomeric FYVE 2015-09-14T11:00:00Z 2015-09-15T02:15:06Z Hrs gene from mouase This is a protein domain from Hrs gene which can bind specifically to PI3P receptor. However, it is unstable in cytoplasm and its affinity for PI3P receptor is not strong enough. false false _2191_ 25576 25576 9 false No false Ho-Tsang Tsai annotation2457766 1 start codon range2457766 1 1 3 annotation2462743 1 FYVE range2462743 1 1 204 BBa_K1769004_sequence 1 atgttcgctgctgaaagagcccctgactgggtggatgctgaggaatgccatcggtgcagagtacagtttggggtggtgacccgcaagcatcactgccgagcatgtgggcagatcttctgtggcaagtgctcctccaagtactccaccatccccaagttcggcattgagaaggaggtgcgcgtgtgtgagccctgctatgagcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z