BBa_K177015 1 BBa_K177015 temp brick 2009-07-07T11:00:00Z 2015-05-08T01:11:05Z human cDNA (HeLa) This is the sequence coding the molecular chaperone, Heat Schock Protein 90 kDa, involved in many important cellular processes false false _284_ 0 2586 9 Not in stock false none false Pawel Krawczyk annotation2010409 1 mito-targeting range2010409 1 1 86 annotation2010408 1 start codon range2010408 1 1 3 BBa_K177015_sequence 1 atgtccgtcctgacgccgctgctgctgcggggcttgacaggctcggcccggcggctcccagtgccgcgcgccaagatccattcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z