BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K1773016 1 BBa_K1773016 pLux/cI right promoter with strong RBS 2015-08-24T11:00:00Z 2015-09-10T12:16:17Z BBa_B0030 pLux/cI promoter with strong RBS. false false _2195_ 27269 27269 9 false Assembled from oligo primers false Sarunas Tumas component2437986 1 BBa_B0030 component2437984 1 BBa_K1773015 annotation2437984 1 BBa_K1773015 range2437984 1 1 78 annotation2437986 1 BBa_B0030 range2437986 1 79 93 BBa_K1773015 1 BBa_K1773015 pLux/ci lambda promoter with 10bp at 3' end for RBS attachment 2015-08-24T11:00:00Z 2015-08-25T05:56:07Z no pLux/ci lambda promoter with 10bp at 3' end for RBS attachment. It is a hipothetical part for assembling pLux/cI+RBS biobricks false false _2195_ 27269 27269 9 false no false Sarunas Tumas BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1773015_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgatacacatgcata BBa_K1773016_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgatacacatgcataattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z