BBa_K1773018 1 BBa_K1773018 pLux/cI right promoter with Weak RBS 2015-08-25T11:00:00Z 2015-08-26T02:14:10Z iGEM parts registry pLux/cI right promoter with Weak RBS. false false _2195_ 27269 27269 9 false Assembled from oligonucleotide primers false Sarunas Tumas component2438007 1 BBa_B0033 component2438005 1 BBa_K1773015 annotation2438007 1 BBa_B0033 range2438007 1 79 89 annotation2438005 1 BBa_K1773015 range2438005 1 1 78 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 annotation7028 1 BBa_B0033 range7028 1 1 11 BBa_K1773015 1 BBa_K1773015 pLux/ci lambda promoter with 10bp at 3' end for RBS attachment 2015-08-24T11:00:00Z 2015-08-25T05:56:07Z no pLux/ci lambda promoter with 10bp at 3' end for RBS attachment. It is a hipothetical part for assembling pLux/cI+RBS biobricks false false _2195_ 27269 27269 9 false no false Sarunas Tumas BBa_B0033_sequence 1 tcacacaggac BBa_K1773018_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgatacacatgcatatcacacaggac BBa_K1773015_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgatacacatgcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z