BBa_K1777000 1 BBa_K1777000 two mir-21 binding sites 2015-09-12T11:00:00Z 2015-09-20T09:18:32Z Renilla luciferase ofthis part come from psiCHECK-2 Vector. This part is composite of a Renilla luciferase and two mir-21 binding sites in the 3'-UTR. With this modification in the 3'-UTR, this luciferase can be as a reporter of mir-21. If this part is expressed in a cell with high level expression of mir-21, it will report a decreased Renilla luciferase activity. false false _2199_ 25645 25645 9 true We use PCR to synthesize the mir-21 binding domain. In order to make sure of this reporter's efficiency, we synthesize two binding sites which are combined together. false Xilin Jiang annotation2476150 1 miR21 binding site range2476150 1 6 26 annotation2476151 1 miR21 binding site range2476151 1 45 65 BBa_K1777000_sequence 1 tcgagtcaacatcaggacataagctagttttactagagtcgagtcaacatcaggacataagctagttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z