BBa_K1777005 1 BBa_K1777005 flexible linker with SV40 NLS 2015-09-12T11:00:00Z 2015-09-19T11:42:57Z This part is improved from BBa_K1486003. This is a 40-50A flexible separation for fusion domains with a SV40 NLS, and its codon is optimized for mammalian. It can be used to link different protein domains for fusion proteins locating in cell nucleus. false false _2199_ 27798 25645 9 false The codon is optimized for mammalian, and we insert a NLS to promote locating in cell nucleus. Besides ,we lengthen this linker to provide better separation of two domains. At last we avoid tandem repeat sequence(like GGGSPKKKRKVGGGS), which will facilitate fusing this linker to your domains via overlap PCR. false Xuhang Li annotation2476145 1 artificial GS linker range2476145 1 45 59 annotation2476147 1 artificial GS linker range2476147 1 110 124 annotation2476144 1 natural flexible linker range2476144 1 3 23 annotation2476143 1 SV40 NLS range2476143 1 89 109 annotation2476142 1 SV40 NLS range2476142 1 24 44 annotation2476139 1 the first linker range2476139 1 3 59 annotation2476141 1 scar from 3A assembly range2476141 1 60 67 annotation2476146 1 natural flexible linker range2476146 1 68 88 annotation2476140 1 the second linker range2476140 1 68 124 BBa_K1777005_sequence 1 agcctcctccataccagcctctccccaagaagaagagaaaggtgggcggcggcggcagctactagagcctcctccataccagcctctccccaagaagaagagaaaggtgggcggcggcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z