BBa_K1777017 1 BBa_K1777017 flexible linker with SV40 NLS 2015-09-16T11:00:00Z 2015-09-17T08:47:30Z This part is improved from BBa_K1486003. This is a 40-50A flexible separation for fusion domains with a SV40 NLS, and its codon is optimized for mammalian. It can be used to link different protein domains for fusion proteins locating in cell nucleus. false false _2199_ 25645 25645 9 false The codon is optimized for mammalian, and we insert a NLS to promote locating in cell nucleus. Besides ,we lengthen this linker to provide better separation of two domains. At last we avoid tandem repeat sequence(like GGGSPKKKRKVGGGS), which will facilitate fusing this linker to your domains via overlap PCR. false Xilin Jiang BBa_K1777017_sequence 1 cctcctccataccagcctctccccaagaagaagagaaaggtgggcggcggcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z