BBa_K1777019 1 BBa_K1777019 flexible linker 2015-09-17T11:00:00Z 2015-09-20T02:06:57Z BBa_K1486003 This a flexible linker combined by two former linkers, which can be easily connect to the end of protein with overlap pcr. false false _2199_ 27798 25645 9 false when we chose a linker for our fusion protein，we would have wanted to use -gggsgggs- linker. But we found that such a tandem repeating linker is hard to work well with overlap PCR because the OE region should be unique. Therefore, we improved the original part by change the first GGGS to a carefully selected natural linker from linker database to avoid repeating sequence. Besides, we used the selected natural linker to adjust its length to about 50A. false Xuhang Li annotation2476148 1 natural linker range2476148 1 1 21 annotation2476149 1 GS linker range2476149 1 22 36 BBa_K1777019_sequence 1 cctcctccataccagcctctcggcggcggcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z