BBa_K1778002 1 BBa_K1778002 TRE-CYC1TATA is a recombinant promoter, which is constructed in order to make the Tet-on system func 2015-09-10T11:00:00Z 2015-09-11T09:27:48Z TRE-CYC1TATA consists of two parts of the TRE compact promoter and CYC1TATA sequence. TRE-CYC1TATA is a recombinant promoter, which is constructed in order to make the Tet-on system function in Pichia pastoris, which is connected in series by TRE promoter and CYC1TATA sequence. The recombinant promoter can be combined with the correct conformation of rtTA to form a regulation mechanism to ensure the validity of the switch. false false _2200_ 25918 25918 9 false When using the part in Pichia pastoris,we need to consider the design of overlapping extension PCR that will be involved in the two part series, TRE compact promoter and CYC1TATA sequence. false Lehua Jia BBa_K1778002_sequence 1 tttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagtttaccactccctatcagtgatagagaaaagtgaaagtcgagctcggtacccgggtcgaggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggtcctttgtagcataaattactatacttctatagacacgcaaacacaaatacacacactaaattaccggatcaattcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z