BBa_K1780008 1 BBa_K1780008 Hybrid Promoter + RBS 2015-09-16T11:00:00Z 2015-09-17T10:28:04Z From previous biobricks This part has a strong RBS (BBa_B0034) downstream of the hybrid promoter placI/ara-1. false false _2205_ 26096 26096 9 false This construct was necessary as the hybrid promoter did not have any RBS in its sequence already. false Snehal Kadam component2466364 1 BBa_B0034 component2466362 1 BBa_K094120 annotation2466362 1 BBa_K094120 range2466362 1 1 103 annotation2466364 1 BBa_B0034 range2466364 1 112 123 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K094120 1 BBa_K094120 pLacI/ara-1 2008-10-12T11:00:00Z 2015-05-08T01:08:40Z Standard pLacI/ara-1 promoter This promoter can be repressed by lacI protein and induced by either IPTG or arabinose. false false _255_ 0 2589 9 It's complicated false IPTG has better effect on this promoter than arabinose false Shi Lei annotation1980631 1 pLac/ara-1 range1980631 1 1 103 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1780008_sequence 1 catagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacagatactagagaaagaggagaaa BBa_K094120_sequence 1 catagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z