BBa_K1780010 1 BBa_K1780010 PRM Promoter (lambda phage - three operator sites) 2015-09-17T11:00:00Z 2015-09-18T03:25:59Z The promoter comes from the DNA sequence of Lambda phage. The promoter has three operator sites named (sequentially) OR1, OR2, OR3. When the gene under the promoter is expressed, its product binds first to site OR1 on the promoter. This ensures (induces) transcription at normal rate. As the gene-product concentration increases, the product also binds to the site OR2 (along with OR1) to enhance the gene transcription (by even a factor of 11 times, according to literature). At very large concentrations of gene product, it now binds to OR3, which causes repression of transcription. Thus concentration of gene product is maintained. false false _2205_ 26624 26624 9 false none false Siddhesh Zadey annotation2470156 1 promoter range2470156 1 1 86 BBa_K1780010_sequence 1 atacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z