BBa_K1780011 1 BBa_K1780011 c1 reppresor gene 2015-09-17T11:00:00Z 2015-09-18T03:39:00Z lambda phage Lysogeny in lambda phage is maintained solely by cI. cI represses transcription from PL and PR while upregulating and controlling its own expression from PRM. It is therefore the only protein expressed by lysogenic phage.cI binds most favorably to OR1; binding here inhibits transcription from PR. As cI easily dimerises, the binding of cI to OR1 greatly increases the affinity of the binding of cI to OR2, and this happens almost immediately after OR1 binding. This activates transcription in the other direction from PRM, as the N terminal domain of cI on OR2 tightens the binding of RNA polymerase to PRM and hence cI stimulates its own transcription. When it is present at a much higher concentration, it also binds to OR3, inhibiting transcription from PRM, thus regulating its own levels in a negative feedback loop.As an additional repression of its own expression, however, cI dimers bound to OR3 and OL3 bend the DNA between them to tetramerise. false false _2205_ 26624 26624 9 false none false Siddhesh Zadey annotation2470195 1 misc range2470195 1 1 819 BBa_K1780011_sequence 1 atgaactatgacgacccaaaaaagaaggttggccgaaacatcaagcgattgaggttaaaagctggcattaaaagtcaagcggccttggcggagctttgcggctggaagtcacaatcaagagtcggtaactatgaggctggtaccagagcagtaagcgctattgatgctgagactctggcgaaagtactcaacgtaacacctgctgagatcctctatggtgaaaacaataaagatgatgactttgttagcatgccaagtgctcaatattcatcaggaccatacgaagaagaagatccgtttcaactatttaaaccaaaacaagaattacaaaatgctgagtggcatgcaggatttgagctatgggatggcgatacaccattaagggatgatgaagtggcactaccgttttaccgtgaagtggaattagccgcaggcagtggatcaacctttgtgcaagaaaacggcggatgcaagctacgctttgctaaatcaaccctcaaaaaaagccgagtagaaccaagcaatgcggcctgtgtgaccgtaagcggcaatagcatgctgccagtactgcgccacggcaccacagttggtgtcgataccagtaaaaaatcgattatcgatggtgagatgtatgccattgatcacgatggcatgttgcgagtaaaaatgctctatcgcaccccaggcggtggcattcgcattaagagctataacaatgatgaattccccgatgaatttatcccaccagaaaaagcatccgatattaaaattatcggttgggtgttttggtggtcagttctaaacgtttggaataattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z