BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1780011 1 BBa_K1780011 c1 reppresor gene 2015-09-17T11:00:00Z 2015-09-18T03:39:00Z lambda phage Lysogeny in lambda phage is maintained solely by cI. cI represses transcription from PL and PR while upregulating and controlling its own expression from PRM. It is therefore the only protein expressed by lysogenic phage.cI binds most favorably to OR1; binding here inhibits transcription from PR. As cI easily dimerises, the binding of cI to OR1 greatly increases the affinity of the binding of cI to OR2, and this happens almost immediately after OR1 binding. This activates transcription in the other direction from PRM, as the N terminal domain of cI on OR2 tightens the binding of RNA polymerase to PRM and hence cI stimulates its own transcription. When it is present at a much higher concentration, it also binds to OR3, inhibiting transcription from PRM, thus regulating its own levels in a negative feedback loop.As an additional repression of its own expression, however, cI dimers bound to OR3 and OL3 bend the DNA between them to tetramerise. false false _2205_ 26624 26624 9 false none false Siddhesh Zadey annotation2470195 1 misc range2470195 1 1 819 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1780013 1 BBa_K1780013 c1 GFP system 2015-09-17T11:00:00Z 2015-09-18T03:56:18Z composite part This part has a c1 repressor gene in tandem with the GFP, which (latter) acts as the reporter for the gene. false false _2205_ 26624 26624 9 false none false Siddhesh Zadey component2470789 1 BBa_B0030 component2470801 1 BBa_B0015 component2470794 1 BBa_E0040 component2470787 1 BBa_K1780010 component2470792 1 BBa_K1780011 annotation2470787 1 BBa_K1780010 range2470787 1 1 86 annotation2470789 1 BBa_B0030 range2470789 1 95 109 annotation2470792 1 BBa_K1780011 range2470792 1 116 934 annotation2470801 1 BBa_B0015 range2470801 1 1669 1797 annotation2470794 1 BBa_E0040 range2470794 1 941 1660 BBa_K1780010 1 BBa_K1780010 PRM Promoter (lambda phage - three operator sites) 2015-09-17T11:00:00Z 2015-09-18T03:25:59Z The promoter comes from the DNA sequence of Lambda phage. The promoter has three operator sites named (sequentially) OR1, OR2, OR3. When the gene under the promoter is expressed, its product binds first to site OR1 on the promoter. This ensures (induces) transcription at normal rate. As the gene-product concentration increases, the product also binds to the site OR2 (along with OR1) to enhance the gene transcription (by even a factor of 11 times, according to literature). At very large concentrations of gene product, it now binds to OR3, which causes repression of transcription. Thus concentration of gene product is maintained. false false _2205_ 26624 26624 9 false none false Siddhesh Zadey annotation2470156 1 promoter range2470156 1 1 86 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1780010_sequence 1 atacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcat BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1780013_sequence 1 atacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcattactagagattaaagaggagaaatactagatgaactatgacgacccaaaaaagaaggttggccgaaacatcaagcgattgaggttaaaagctggcattaaaagtcaagcggccttggcggagctttgcggctggaagtcacaatcaagagtcggtaactatgaggctggtaccagagcagtaagcgctattgatgctgagactctggcgaaagtactcaacgtaacacctgctgagatcctctatggtgaaaacaataaagatgatgactttgttagcatgccaagtgctcaatattcatcaggaccatacgaagaagaagatccgtttcaactatttaaaccaaaacaagaattacaaaatgctgagtggcatgcaggatttgagctatgggatggcgatacaccattaagggatgatgaagtggcactaccgttttaccgtgaagtggaattagccgcaggcagtggatcaacctttgtgcaagaaaacggcggatgcaagctacgctttgctaaatcaaccctcaaaaaaagccgagtagaaccaagcaatgcggcctgtgtgaccgtaagcggcaatagcatgctgccagtactgcgccacggcaccacagttggtgtcgataccagtaaaaaatcgattatcgatggtgagatgtatgccattgatcacgatggcatgttgcgagtaaaaatgctctatcgcaccccaggcggtggcattcgcattaagagctataacaatgatgaattccccgatgaatttatcccaccagaaaaagcatccgatattaaaattatcggttgggtgttttggtggtcagttctaaacgtttggaataattgatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K1780011_sequence 1 atgaactatgacgacccaaaaaagaaggttggccgaaacatcaagcgattgaggttaaaagctggcattaaaagtcaagcggccttggcggagctttgcggctggaagtcacaatcaagagtcggtaactatgaggctggtaccagagcagtaagcgctattgatgctgagactctggcgaaagtactcaacgtaacacctgctgagatcctctatggtgaaaacaataaagatgatgactttgttagcatgccaagtgctcaatattcatcaggaccatacgaagaagaagatccgtttcaactatttaaaccaaaacaagaattacaaaatgctgagtggcatgcaggatttgagctatgggatggcgatacaccattaagggatgatgaagtggcactaccgttttaccgtgaagtggaattagccgcaggcagtggatcaacctttgtgcaagaaaacggcggatgcaagctacgctttgctaaatcaaccctcaaaaaaagccgagtagaaccaagcaatgcggcctgtgtgaccgtaagcggcaatagcatgctgccagtactgcgccacggcaccacagttggtgtcgataccagtaaaaaatcgattatcgatggtgagatgtatgccattgatcacgatggcatgttgcgagtaaaaatgctctatcgcaccccaggcggtggcattcgcattaagagctataacaatgatgaattccccgatgaatttatcccaccagaaaaagcatccgatattaaaattatcggttgggtgttttggtggtcagttctaaacgtttggaataattga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z