BBa_K1781002 1 BBa_K1781002 ZHER2 - affibody with affinity to cytoplasmic domain of HER2 2015-09-08T11:00:00Z 2015-09-11T01:18:01Z The sequence was received from the scientific paper by Charles Eigenbrot in 2010, who engineered ZHER2 to have a better affinity towards HER2. ZHER2 was one of the first affibodies created and it binds to the Human Epidermal Growth Factor 2 (HER2). They originate from mutations in the Immunoglobin G Binding Domain of Protein A from Staphylococcus aureus. Affibodies are engineered to bind to larger proteins or peptides where they imitate monoclonal antibodies. They are used in a multitude of therapies in biotechnology to bioimaging. ZHER2 can particular be used as a protein-protein interaction tool, as well as a way to verify antibody interactions as it binds to the cytoplasmic domain of HER2 at a different epitope than the antibodies. false false _2206_ 25533 25533 9 false As it is only 58 amino acids long, the small size of the sequence can be problematic towards cloning and recombineering procedures false Marvin Prein annotation2448986 1 ZHER2 range2448986 1 1 228 BBa_K1781002_sequence 1 atggccggcggcagcagccaccaccaccaccaccacctgcaagtggacaacaagttcaacaaggagatgaggaacgcctactgggagatcgccctgctgcccaacctgaacaaccagcagaagagggccttcatcaggagcctgtacgacgaccccagccagagcgccaacctgctggccgaggccaagaagctgaacgacgcccaggcccccaagtaaaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z