BBa_K1781003 1 BBa_K1781003 T25 - one of two fragments of the T25/T18 BACTH system 2015-09-08T11:00:00Z 2015-09-16T04:48:26Z The sequence was retrieved from the Euromedex BACTH System Kit The T25 sequence fragment is one part of the T25/T18 BACTH system. This system is used to detect protein-protein interactions. Each one of the fragments are bound to a target protein, and when these proteins interact the T25 and T18 subunits are able to connect and restore the ability to produce cyclic AMP. This then induces the expression of lac-Z and thus can be detected on agar plates containing X-gal. false false _2206_ 25843 25533 9 false We removed the multiple cloning site within the T25 so that it did not interfere with the prefix and suffix false Marvin Prein annotation2462351 1 T 25 range2462351 1 1 711 annotation2462350 1 T 25 range2462350 1 1 711 BBa_K1781003_sequence 1 ataaggaggtactacatggccggcaccatgcagcaatcgcatcaggctggttacgcaaacgccgccgaccgggagtctggcatccccgcagccgtactcgatggcatcaaggccgtggcgaaggaaaaaaacgccacattgatgttccgcctggtcaacccccattccaccagcctgattgccgaaggggtggccaccaaaggattgggcgtgcacgccaagtcgtccgattgggggttgcaggcgggctacattcccgtcaacccgaatctttccaaactgttcggccgtgcgcccgaggtgatcgcgcgggccgacaacgacgtcaacagcagcctggcgcatggccataccgcggtcgacctgacgctgtcgaaagagcggcttgactatctgcggcaagcgggcctggtcaccggcatggccgatggcgtggtcgcgagcaaccacgcaggctacgagcagttcgagtttcgcgtgaaggaaacctcggacgggcgctatgccgtgcagtatcgccgcaagggcggcgacgatttcgaggcggtcaaggtgatcggcaatgccgccggtattccactgacggcggatatcgacatgttcgccattatgccgcatctgtccaacttccgcgactcggcgcgcagttcggtgaccagcggcgattcggtgaccgattacctggcgcgcacgcggcgggctaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z