BBa_K1781005 1 BBa_K1781005 LZ-T25 - Leucine Zipper bound to T25 fragment of BACTH 2015-09-08T11:00:00Z 2015-09-11T01:20:34Z The sequence was retrieved from the Euromedex BACTH System Kit. Leucine zippers are one of the most common protein-binding motifs. The gene codes for an alpha helix that contains a high amount of leucine residues. This alpha helix can interact with another leucine zipper and dimerize. This interaction has been thoroughly characterized and confirmed as a good control. The leucine zipper here is bound to the T25 subunit of the BACTH system and can be used as a control for the T18 and T25 interactions. false false _2206_ 25533 25533 9 false We did not have to change anything during the design procedure for this sequence. false Marvin Prein annotation2448984 1 LZ-T25 range2448984 1 1 123 BBa_K1781005_sequence 1 atggccggcatccagcgtatgaaacagctggaagacaaagttgaagagctcctgagcaaaaactaccacctggagaacgaagttgcgcgcctgaaaaaactggtgggtgaacgtaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z