BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K081005 1 BBa_K081005 constitutive promoter family member and RBS 2008-10-17T11:00:00Z 2015-05-08T01:08:34Z Promoter: John Anderson. RBS: Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. Released HQ 2013 Constitutive promoter (strong) with RBS (strong, efficiency=0.3) false true _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981863 1 BBa_J23100 component1981865 1 BBa_B0030 annotation1981863 1 BBa_J23100 range1981863 1 1 35 annotation1981865 1 BBa_B0030 range1981865 1 44 58 BBa_K1783002 1 BBa_K1783002 Constitutive Promoter-RBS-Unstable RFP (LVA-Tagged) 2015-07-17T11:00:00Z 2015-09-25T10:32:37Z Promoter, RBS, LVA tag from E. coli RFP from Discosoma striata Produces unstable RFP under a constitutive promoter. false false _2208_ 26311 20382 9 false none false Chun Mun Loke, Adam Wahab, Kimia Abtahi, Iowis Zhu component2433285 1 BBa_K081005 component2433291 1 BBa_K1399001 annotation2433291 1 BBa_K1399001 range2433291 1 65 778 annotation2433285 1 BBa_K081005 range2433285 1 1 58 BBa_K1783001 1 BBa_K1783001 Hok/Sok Type I Toxin/Antitoxin Cassette 2015-06-29T11:00:00Z 2015-09-25T09:23:34Z K-12 plasmid pDM0133 Alternative maintenance system false false _2208_ 26311 20382 9 false Overlaps needed to be added for Gibson Assembly. false Iowis Zhu annotation2432920 1 Full-length Hok Transcript range2432920 1 128 572 annotation2432919 1 Hok Stop Codon range2432919 1 460 463 annotation2432917 1 Hok Promoter range2432917 1 96 125 annotation2432922 1 Mok range2432922 1 246 458 annotation2432921 1 End of Truncated Hok Transcript range2432921 1 495 498 annotation2432918 1 Sok Transcript range2432918 1 29 259 BBa_K1783003 1 BBa_K1783003 Unstable RFP under Hok/Sok Regulation 2015-08-13T11:00:00Z 2015-09-25T09:08:37Z See construction parts. Produces unstable RFP under a constitutive promoter. This construct carries the hok-sok toxin-antitoxin (TA) plasmid maintenance system and was used to measure the ability of this alternative plasmid maintenance system to keep plasmids within the cell without the use of antibiotics. false false _2208_ 26311 20382 9 false PCR of Hok-Sok component was difficult due to high inherent secondary structure of the gene sequences. DMSO was needed in order to break this structure. false Iowis Zhu component2435665 1 BBa_K1783002 component2435653 1 BBa_K1783001 annotation2435665 1 BBa_K1783002 range2435665 1 581 1358 annotation2435653 1 BBa_K1783001 range2435653 1 1 580 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1399001 1 BBa_K1399001 RFP from Discosoma striata (coral) with LVA-ssrA degradation tag 2014-09-17T11:00:00Z 2015-05-08T01:10:15Z RFP comes from part BBa_E1010, tag sequence was obtained from paper by Andersen et al., (1998).[2] Mutant RFP from Discosoma striata (coral) (see part BBa_E1010) with added LVA-ssrA degradation tag. The tag increases RFP turn-over rate, thus providing better temporal resolution of red fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. This tag is commonly attached to repressor proteins for use in various gene networks (e.g., oscillators). The tag encodes peptide sequence AANDENYALVA and is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The LVA tag is reported to lead to fast protein degradation, degrading GFP with rate -0.018 per minute.[2] However, be aware that exact protein degradation rate depends on multiple factors: ClpXP and ClpAP protease and SspB mediator concentrations; protein stability; Km of binding to the protease; temperature [3]. References: [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 0 22477 9 In stock true The tag was attached to RFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additonal residues and restriction sites. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (LVA in this case) are recognised by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383873 1 cds range2383873 1 4 675 annotation2383875 1 stop range2383875 1 709 711 annotation2383874 1 LVA-ssrA tag range2383874 1 676 708 annotation2383876 1 stop range2383876 1 712 714 annotation2383872 1 start range2383872 1 1 3 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1399001_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_K081005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1783003_sequence 1 aacaaactccgggaggcagcgtgatgcggcaacaatcacacggatttcccgtgaacggtctgaatgagcggattattttcagggaaagtgagtgtggtcagcgtgcaggtatatgggctatgatgtgcccggcgcttgaggctttctgcctcatgacgtgaaggtggtttgttgccgtgttgtgtggcagaaagaagatagccccgtagtaagttaattttcattaaccaccacgaggcatccctatgtctagtccacatcaggatagcctcttaccgcgctttgcgcaaggagaagaaggccatgaaactaccacgaagttcccttgtctggtgtgtgttgatcgtgtgtctcacactgttgatattcacttatctgacacgaaaatcgctgtgcgagattcgttacagagacggacacagggaggtggcggctttcatggcttacgaatccggtaagtagcaacctggaggcgggcgcaggcccgccttttcaggactgatgctggtctgactactgaagcgcctttataaaggggctgctggttcgccggtagcccctttctccttgctgatgttgtttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_K1783001_sequence 1 aacaaactccgggaggcagcgtgatgcggcaacaatcacacggatttcccgtgaacggtctgaatgagcggattattttcagggaaagtgagtgtggtcagcgtgcaggtatatgggctatgatgtgcccggcgcttgaggctttctgcctcatgacgtgaaggtggtttgttgccgtgttgtgtggcagaaagaagatagccccgtagtaagttaattttcattaaccaccacgaggcatccctatgtctagtccacatcaggatagcctcttaccgcgctttgcgcaaggagaagaaggccatgaaactaccacgaagttcccttgtctggtgtgtgttgatcgtgtgtctcacactgttgatattcacttatctgacacgaaaatcgctgtgcgagattcgttacagagacggacacagggaggtggcggctttcatggcttacgaatccggtaagtagcaacctggaggcgggcgcaggcccgccttttcaggactgatgctggtctgactactgaagcgcctttataaaggggctgctggttcgccggtagcccctttctccttgctgatgttgt BBa_K1783002_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z