BBa_K1787001 1 Mod. Bact. Modified Bacteria Lipoprotein 2015-09-17T11:00:00Z 2015-09-18T11:58:31Z The DNA sequence encoding for the protein was modified so as to reduce non-polar amino acids in between the polar amino-acids. It was introduced into BBa_K1321338 (containing a T7 promoter with a RBS). This part contains a T7 promoter with a Ribosome Binding Site next to it; additionally, it encodes for a Bacterial Modified Lipoprotein. We have preliminary data that suggests that after isolation, run through an SDS-PAGE, and silver staining, this protein shows a different colouration than that of the normal silver stained protein gels. false false _2212_ 25741 25741 9 false In order for our sequence to be synthesized, we had to intercalate non-polar amino acids between the polar amino acids. This, in order to make the protein that is synthesized by the sequence more reactive with the silver staining reagents. false Joy R. L. Santos annotation2473453 1 BBa_K1321338 range2473453 1 1 43 annotation2473456 1 Scar (SpeI/XbaI) range2473456 1 44 51 annotation2473459 1 Modified Bacteria Lipoprotein range2473459 1 52 763 BBa_K1787001_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagaggcattctaggatcaggaggacagctatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagctgtcttctgacgttcagactctgaacgctaaagttgaccagctgagcaacgacgtgaacgcaatgcgttccgacgttcaggctgctaaagatgacgcagctcgtgctaaccagcgtctggacaacatggctactaaataccgcaagatgaaggctactaagttggttctaggtgcggtaattctcggaagtacgctcctggctgggtgtagttctaatgcgaaaatagaccagctgagtagcgatgtacagacactaaatgccaaggtcgaccaactcagtaacgatgtgaatgcaatgagaagcgacgttcaagccgctaaagacgatgccgctagagcaaatcaaagactcgataacatggccacgaagtataggaagatgaaggcaacaaaacttgtcctcggggcagttatcctaggaagtacactactggcaggctgtagtagtaacgcaaaaatagaccaactcagcagcgatgtgcagacactaaatgcaaaggtcgaccaactgagtaatgatgtcaacgcaatgcgaagcgatgtccaggcggctaacgacgatgccgcaagggcgaatcaacgactcgataacatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z