BBa_K1789004 1 BBa_K1789004 GFP2 2015-09-13T11:00:00Z 2016-01-25T01:04:48Z This part is gained from part BBa_I715020. This part is the Carboxyl Half of GFP false false _2214_ 4206 21134 9 false we REMOVED the extra base from part BBa_I715020(easier to fuse with other proteins) when designing PCR primers to make the protein fusion easier. false Xinyuan Qiu annotation2454067 1 GFP2 range2454067 1 1 249 BBa_K1789004_sequence 1 aagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z