BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_K1789012 1 BBa_K1789012 P+R 2015-09-13T11:00:00Z 2015-09-14T07:22:47Z It is formed by our basic parts. This part is a promoter. It has a strong RBS restriction site following it which can guarantee the high efficiency of our project. false false _2214_ 26298 26298 9 false We want to construct a promoter which has RBS30 itself for RBS30 is small. If we supply a promoter with RBS, the efficiency of building will be high. false Jiaqi Sun component2454122 1 BBa_R0010 component2454130 1 BBa_K1789002 annotation2454122 1 BBa_R0010 range2454122 1 1 200 annotation2454130 1 BBa_K1789002 range2454130 1 209 223 BBa_K1789002 1 BBa_K1789002 RBS30 2015-09-13T11:00:00Z 2015-09-14T06:03:14Z The part sequence was gained from the registry, the part is annealed from the ssDNA synthesized by Life(R). This part is another copy of the RBS30 (BBa_B0030). It is a Strong RBS based on Ron Weiss thesis. false false _2214_ 21134 21134 9 false The reason why we built this part by ourselves is that the copy of B0030 in the 2015 DNA distribution we received is sequenced as incorrect. And same problem also occurred in several other teams. false Xinyuan Qiu annotation2454064 1 RBS30 range2454064 1 1 15 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K1789002_sequence 1 attaaagaggagaaa BBa_K1789012_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z