BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1789005 1 BBa_K1789005 SCAF1 2015-09-13T11:00:00Z 2015-09-14T06:57:36Z This part is synthesized by company This part is a scaffold system contains the recognizing motifs of TALE1 and TALE3 false false _2214_ 21134 21134 9 false We designed this sequence to provide sites for our engineered TALE proteins to bind false Xinyuan Qiu annotation2454071 1 TALE1 BINDING SITE range2454071 1 1 14 annotation2454074 1 TALE3 BINDING SITE range2454074 1 15 28 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1789013 1 BBa_K1789013 SCAF1+Ter 2015-09-13T11:00:00Z 2015-09-14T07:53:47Z It is constructed by our own basic parts. This is a combination of scaffold and termination. false false _2214_ 26298 26298 9 false We want to construct a part which can have both the function of scaffold system and termination. false Jiaqi Sun component2454229 1 BBa_B0015 component2454232 1 BBa_K1789005 annotation2454229 1 BBa_B0015 range2454229 1 1 129 annotation2454232 1 BBa_K1789005 range2454232 1 138 467 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1789005_sequence 1 tggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttc BBa_K1789013_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttctggaggcaccggtggtgataaacacctttc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z