BBa_K179000 1 BBa_K179000 XRE human enhancer enhanced by Ahr-Arnt-dioxin complex 2009-10-17T11:00:00Z 2015-05-08T01:11:05Z XRE human genomic sequence XRE works as dioxin sensor when co-expressed with Arnt and Ahr. Dioxin first binds to the Ahr protein, and this Dioxin-Ahr binds to Arnt. The resulting complex in cytosol is then transfered to the nucleus and bind to the XRE sequences, which works as enhancer of downstream promoter. false false _300_ 0 5071 9 Not in stock false To use as a dioxin sensor, you must use this part with Arnt and Ahr protein coding devices. false Yoko Tomizawa annotation2049341 1 XRE range2049341 1 29 41 annotation2049340 1 XRE range2049340 1 15 28 annotation2049339 1 XRE range2049339 1 1 14 BBa_K179000_sequence 1 atccttgcgtgacaatccttgcgtgacaatccttgcgtgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z