BBa_K1791000 1 BBa_K1791000 Theophylline dependent ribozyme 2015-09-16T11:00:00Z 2015-09-17T09:44:15Z Adapted from Win and Smolke (2007). A modular and extensible RNA-based gene-regulatory platform for engineering cellular function. PNAS. 104(36):14283-8. Theophylline dependent ribozyme with a spacer sequence (AU rich) flanking both sides of the part to assist in proper folding of the ribozyme. The ribozyme has been shown to induce cleave in vivo upon the addition of theophylline. However expressing it in vitro results in cleavage of the ribozyme both with and without the addition of theophylline. false false _2216_ 17031 17031 9 false We have tested various temperatures, Magnesium and spermidine concentration under in vitro conditions but were unable to prevent the ribozmye from cleaving without the addition of theophylline. We will be investigating mutations to the theophylline ribozyme in order to optimize it for invitro conditions. false Graeme Glaister annotation2466187 1 Theophylline aptazyme range2466187 1 12 108 BBa_K1791000_sequence 1 aaacaaacaaagctgtcaccggatgtgctttccggtctgatgagtccgtgttgctgataccagcatcgtcttgatgcccttggcagcagtggacgaggacgaaacagcaaaaagaaaaataaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z