BBa_K1791006 1 BBa_K1791006 MS2 binding domain 2015-09-22T11:00:00Z 2015-09-22T11:21:29Z genomic sequence in E.coli This is an aptamer designed to bind MS2 coat protein upon transcription. false false _2216_ 17031 17031 9 false Had to test that it optimally binds to MS2 coat protein in vivo false Graeme Glaister BBa_K1791006_sequence 1 gaaaagaaaacatgaggatcacccatgtcaaaagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z