BBa_J23107 1 BBa_J23107 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 It's complicated true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1792001 1 BBa_K1792001 Petal Death Protein (PDP) - Oxalic acid production 2015-09-16T11:00:00Z 2015-09-17T12:37:59Z Petal Death Protein (PDP) from Dianthus caryophyllus (Carnation) (Clove pink). Based on the genomic sequence submitted to UniprotKB - Q05957 (PDP_DIACA). This part exists only as a composite part. See BBa_K1792000. Petal Death Protein (PDP) from Dianthus caryophyllus (Carnation) (Clove pink). PDP catalyzes the production of Oxalic acid from Oxaloacetate: Oxaloacetate + H2O = oxalate + acetate. The first 3 amino acids represent a propeptide and are not included in the PDP sequence. The PDP gene is under control of the constitutively active medium transcription promoter J23107. false false _2217_ 28641 28641 9 false The first 3 amino acids represent a propeptide and are not included in the PDP sequence. A Met was added at the start of the coding sequence. false Brian Dempsey BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K1792000 1 BBa_K1792000 Petal Death Protein (PDP) - Oxalic acid production 2015-09-16T11:00:00Z 2015-09-17T12:39:15Z Petal Death Protein (PDP) from Dianthus caryophyllus (Carnation) (Clove pink). Based on the genomic sequence submitted to UniprotKB - Q05957 (PDP_DIACA). Petal Death Protein (PDP) from Dianthus caryophyllus (Carnation) (Clove pink). PDP catalyzes the production of Oxalic acid from Oxaloacetate: Oxaloacetate + H2O = oxalate + acetate. The first 3 amino acids represent a propeptide and are not included in the PDP sequence. The PDP gene is under control of the constitutively active medium transcription promoter J23107. false false _2217_ 28641 28641 9 false The PDP gene is under control of the constitutively active medium transcription promoter J23107. It is possible to turn Oxalic acid production up or down by mutating this promoter to a stronger or weaker promoter. false Brian Dempsey component2466765 1 BBa_J23107 component2466767 1 BBa_B0034 component2466775 1 BBa_B0015 component2466768 1 BBa_K1792001 annotation2466767 1 BBa_B0034 range2466767 1 44 55 annotation2466768 1 BBa_K1792001 range2466768 1 62 1009 annotation2466765 1 BBa_J23107 range2466765 1 1 35 annotation2466775 1 BBa_B0015 range2466775 1 1018 1146 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1792001_sequence 1 atgccgaatggtaccaccaacggtgaaactgaagtcgcaacgcaaggtagctatacggcggtgtctactgggcggaaaaccaccatgcaccgcttaattgaagaacatggttctgttcttatgccgggcgtacaagacgcgctgtcagcagccgtggtggaaaaaacagggttccatgcggcattcgtgagcggatacagcgtctctgcggccatgctgggccttcctgatttcggcctgctgactaccaccgaagtagttgaggcaacgcgtcgtattaccgcagcggccccgaatctgtgcgttgtggttgatggtgataccggagggggcggtccattgaacgtacagcggttcatccgcgagctgatctcggcgggcgcaaaaggcgtttttttagaagatcaagtgtggcctaaaaaatgtgggcacatgcgtggcaaggcggtagtgcctgccgaagaacacgctctgaaaattgcggcggcccgtgaggctattggtgatagtgatttttttttggtggcgcgtacggacgcgcgcgctccgcacgggctggaggaaggcatccgtcgcgcgaacctctacaaagaggctggggccgatgcaacctttgtggaagccccggccaacgtggatgagctcaaagaggtaagtgccaaaacgaagggcctgcgcatcgccaatatgattgaaggcggcaaaacaccgctgcataccccggaggagtttaaagaaatgggtttccatctgatcgcccattctttaaccgcggtttatgccacggcccgcgcactggttaacattatgaaaatcctgaaagaaaaaggcacaactcgcgatgatttggatcagatggcgacttttagcgaatttaatgaactgatcagcttagaatcctggtatgaaatggaaagcaaatttaagaactttactccgaaagcgaca BBa_J23107_sequence 1 tttacggctagctcagccctaggtattatgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1792000_sequence 1 tttacggctagctcagccctaggtattatgctagctactagagaaagaggagaaatactagatgccgaatggtaccaccaacggtgaaactgaagtcgcaacgcaaggtagctatacggcggtgtctactgggcggaaaaccaccatgcaccgcttaattgaagaacatggttctgttcttatgccgggcgtacaagacgcgctgtcagcagccgtggtggaaaaaacagggttccatgcggcattcgtgagcggatacagcgtctctgcggccatgctgggccttcctgatttcggcctgctgactaccaccgaagtagttgaggcaacgcgtcgtattaccgcagcggccccgaatctgtgcgttgtggttgatggtgataccggagggggcggtccattgaacgtacagcggttcatccgcgagctgatctcggcgggcgcaaaaggcgtttttttagaagatcaagtgtggcctaaaaaatgtgggcacatgcgtggcaaggcggtagtgcctgccgaagaacacgctctgaaaattgcggcggcccgtgaggctattggtgatagtgatttttttttggtggcgcgtacggacgcgcgcgctccgcacgggctggaggaaggcatccgtcgcgcgaacctctacaaagaggctggggccgatgcaacctttgtggaagccccggccaacgtggatgagctcaaagaggtaagtgccaaaacgaagggcctgcgcatcgccaatatgattgaaggcggcaaaacaccgctgcataccccggaggagtttaaagaaatgggtttccatctgatcgcccattctttaaccgcggtttatgccacggcccgcgcactggttaacattatgaaaatcctgaaagaaaaaggcacaactcgcgatgatttggatcagatggcgacttttagcgaatttaatgaactgatcagcttagaatcctggtatgaaatggaaagcaaatttaagaactttactccgaaagcgacatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z