BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1792005 1 BBa_K1792005 Nuclease - secreted with Cterm 6xHis tag 2015-09-16T11:00:00Z 2015-09-17T02:27:52Z This is a genomic sequence of Nuclease from Staphylococcus aureus. Found in the UniprotKB database: P00644 (NUC_STAAU). The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. This part exists as a basic part only. For a working part see the composite part: BBa_K1792004 Nuclease from Staphylococcus aureus. This nuclease is secreted due to a bacterial N-terminal export tag. The nuclease contains a C-terminal 6xHis tag for possible purification and concentration. This part is the same as BBa_K729004 with the addition of the his-tag. Endonucleolytic cleavage to nucleoside 3'-phosphates and 3'-phosphooligonucleotides (Enzyme that catalyzes the hydrolysis of both DNA and RNA at the 5' position of the phosphodiester bond.) false false _2217_ 28641 28641 9 false The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. false Brian Dempsey BBa_K1792004 1 BBa_K1792004 Nuclease - secreted with Cterm 6xHis tag 2015-09-16T11:00:00Z 2015-09-17T02:28:53Z This is a genomic sequence of Nuclease from Staphylococcus aureus. Found in the UniprotKB database: P00644 (NUC_STAAU). The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. Nuclease from Staphylococcus aureus. This nuclease is secreted due to a bacterial N-terminal export tag. The nuclease contains a C-terminal 6xHis tag for possible purification and concentration. This part is the same as BBa_K729004 with the addition of the his-tag. Endonucleolytic cleavage to nucleoside 3'-phosphates and 3'-phosphooligonucleotides (Enzyme that catalyzes the hydrolysis of both DNA and RNA at the 5' position of the phosphodiester bond.) The protein is undercontrol of an IPTG inducible promoter. false false _2217_ 28641 28641 9 false The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. false Brian Dempsey component2466962 1 BBa_B0015 component2466955 1 BBa_K1792005 component2466954 1 BBa_K613010 annotation2466954 1 BBa_K613010 range2466954 1 1 114 annotation2466962 1 BBa_B0015 range2466962 1 705 833 annotation2466955 1 BBa_K1792005 range2466955 1 121 696 BBa_K613010 1 BBa_K613010 T7 promoter family member (LacI repressed) 2011-09-20T11:00:00Z 2015-05-08T01:12:54Z synthetic Parts K613007 through K613012 are T7 promoter variants containing the lac operator just downstream of the T7 promoter. K613007 contains the T7 promoter wildtype sequence. The other sequences were derived by single base pair mutations that have been shown to alter its strength. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the reporter construct. false false _785_ 0 7125 9 Not in stock false Imburgio, D., Rong, M., Ma, K. & McAllister, W.T. Studies of promoter recognition and start site selection by T7 RNA polymerase using a comprehensive collection of promoter variants. Biochemistry 39, 10419???10430 (2000). false Alessandro Ferrari, Vincent Zimmern, Nadine Guenat, Henrike Niederholtmeyer annotation2136239 1 lac operator range2136239 1 55 75 annotation2136238 1 T7 promoter range2136238 1 30 52 annotation2136240 1 RBS range2136240 1 107 112 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K613010_sequence 1 gaagcgagaggatcttaaggctagagtaccaatacgactcactatagggagaggaattgtgagcggataacaattcccactagaaataattttgtttaacttaagaaggaggaa BBa_K1792005_sequence 1 atgaaaaaaatttggttagcgctggcgggtttggtcctggccttttctgccagcgcgcagacggacaatggagttaaccgtagtgggtcagaagatccgacagtgtattcagcgaccagcactaaaaaacttcacaaagaaccggcaaccctgattaaagccatcgacggcgacacagtgaaattgatgtataaaggtcagccgatgaccttccgcctcctgctggtggataccccggaaaccaaacatccgaagaagggtgtcgagaaatacggtccggaagccagcgcctttacgaagaaaatggtggaaaatgcgaagaaaattgaagtagaatttgataaaggtcagcgcacggacaaatacgggcgtggtctggcctatatttacgcggacggcaaaatggttaacgaagccttggttcgtcagggtctggcaaaagtggcatatgtttacaaaccgaataatacccacgaacaacacctgcgtaaaagtgaagcgcaggcaaaaaaggaaaaattaaacatttggagcgaagataatgccgactctggccaacatcaccaccaccaccat BBa_K1792004_sequence 1 gaagcgagaggatcttaaggctagagtaccaatacgactcactatagggagaggaattgtgagcggataacaattcccactagaaataattttgtttaacttaagaaggaggaatactagatgaaaaaaatttggttagcgctggcgggtttggtcctggccttttctgccagcgcgcagacggacaatggagttaaccgtagtgggtcagaagatccgacagtgtattcagcgaccagcactaaaaaacttcacaaagaaccggcaaccctgattaaagccatcgacggcgacacagtgaaattgatgtataaaggtcagccgatgaccttccgcctcctgctggtggataccccggaaaccaaacatccgaagaagggtgtcgagaaatacggtccggaagccagcgcctttacgaagaaaatggtggaaaatgcgaagaaaattgaagtagaatttgataaaggtcagcgcacggacaaatacgggcgtggtctggcctatatttacgcggacggcaaaatggttaacgaagccttggttcgtcagggtctggcaaaagtggcatatgtttacaaaccgaataatacccacgaacaacacctgcgtaaaagtgaagcgcaggcaaaaaaggaaaaattaaacatttggagcgaagataatgccgactctggccaacatcaccaccaccaccattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z