BBa_K1795102 1 BBa_K1795102 R0010 N20 sequence 2015-09-16T11:00:00Z 2015-09-17T08:10:27Z Based off of BBa_R0010 N20 sequence targeting R0010 for use in gRNA parts false false _2220_ 27446 27446 9 false Picked site upstream of NGG sequence false Joseph L Maniaci BBa_K1795102_sequence 1 atgttgtgtggaattgtgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z