BBa_K1795104 1 BBa_K1795104 R0062 N20 gRNA sequence 2015-09-16T11:00:00Z 2015-09-17T08:22:03Z Based off the R0062 promoter sequence N20 sequence for the R0062 gRNA false false _2220_ 21426 21426 9 false false Taylor Jacobs BBa_K1795104_sequence 1 tacaggtttacgcaagaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z