BBa_K1795113 1 BBa_K1795113 Origene Scrambled gRNA 2015-09-16T11:00:00Z 2015-09-17T08:54:12Z The N20 sequence was used with Origene???s permission and was taken from Origene???s pCas Scramble (GE100003). Scrambled gRNA sequence used as a control false false _2220_ 21426 21426 9 false false Taylor Jacobs BBa_K1795113_sequence 1 gcactaccagagctaactca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z