BBa_K1795203 1 BBa_K1795203 H2 region GalK 2015-09-16T11:00:00Z 2015-09-17T10:56:05Z GalK Homologous Sequence modeled after sequence used in Elowitz, M. B., Levine, A. J., Siggia, E. D., & Swain, P. S. (2002). Stochastic gene expression in a single cell. Science, 297(5584), 1183-1186. GalK homologous region H2: Based off of Elowitz et al 2002, Used in construction of K1795023 false false _2220_ 27446 27446 9 false false Joseph L Maniaci BBa_K1795203_sequence 1 ttcttacactccggattcgcgaaaatggatatcgctgactgcgcgcaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z