BBa_K1796001 1 Pnif promoter of Paenibacillus sp. WLY78 nif gene cluster 2015-09-16T11:00:00Z 2015-09-18T02:35:42Z Pnif is from Paenibacillus sp. WLY78 genome,located upstream of nifB,the first gene of nitrogen fixation cluster. The promoter of Paenibacillus sp. WLY78 nif gene cluster, We named it Pnif. Pnif is a σ70-dependent promoter located upstream of nifB. Pnif is in control of all the gene clusters of nitrogen fixation genome. Confirmation of nif promoter We standardized the nif promoter of Paenibacillus sp. WLY78, and linked it to the upstream of 3 reporter genes (RFP reporter: BBa_K1357010, YFP reporter: BBa_E0430;amilCP reporter: BBa_K1357009) to confirm the reliability of this promoter. The results are shown in Figure 2. A B C http://2015.igem.org/wiki/images/b/b2/Confirmation_of_Pnif_AB.png http://2015.igem.org/wiki/images/thumb/3/34/C-confirmation_of_Pnif.jpeg/622px-C-confirmation_of_Pnif.jpeg Fig.4. Confirmation of nif promoter of Paenibacillus sp. WLY78. (A) Pnif+RFP reporter; (B) Pnif+YFP reporter;(C)Pnif+amilCP reporter. The results confirmed the reliability of Pnif. The initiation of Pnif does not require inducement. Thus it is a effective constitutive promoter. false false _2221_ 12637 23592 9 false effeciency of the promoter in E.coli for ordinary parts false Nannan Xie annotation2473661 1 Pnif range2473661 1 1 100 annotation2473637 1 -35 range2473637 1 62 67 annotation2473660 1 -10 range2473660 1 85 90 BBa_K1796001_sequence 1 cgtaaaatttgacacatatgtgaattgaggataaatgtcagggatttcatggagaagtgaattgactgtatttgtccctgtctctaagatgtaattatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z