BBa_K1796012 1 BBa_K1796012 nifX promoted from Paenibacillus sp. WLY78 2015-09-16T11:00:00Z 2015-09-17T08:52:34Z NifX(BBa_K1796012) is taken from genomic sequence of Paenibacillus sp.WLY78, we apply promotions on the sequences and synthesised it. Function: encode carrier proteins involved in the delivery of FeMoco to the MoFe protein , participate in FeMoco assembly in a chaperone-like function. false false _2221_ 23592 23592 9 false We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves（done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site（one PstI） was involved after they promoted it again. But the part can be assembled by gibson assembly,that is what we did. false Nannan Xie annotation2473705 1 nifX coding sequence range2473705 1 22 414 annotation2475144 1 unknown rbs range2475144 1 1 21 BBa_K1796012_sequence 1 tgccgagagggggaggggaggatgaaagttgcgtttgcaaccgaagacggcgttctggtaaacgcacattttggccagagcccgatgtttaccatcttcgaaatccgccactctggcgttcagtttctggaacatcgtcgtattgcgctgggttctgacgaaaacgaagcaggcaaaatcgcgagccgtattggtctgattgaagactgcgcgctgatctttctggttcaaattggcgcaagcgcagcagcacaagttaccaaacgcaccatcatgccggtcaaagttgcatttggcagcaccattgaagaacaggtacagcgtctgcagaatatgctgacccgtaatccgccgatgtggctggcaaaaattctgcacgcagaagaaggttctggtaaagcagaaagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z