BBa_K1796013 1 BBa_K1796013 hesA promoted from Paenibacillus sp. WLY78 2015-09-16T11:00:00Z 2015-09-17T08:57:35Z It is taken from genomic sequence of Paenibacillus sp.WLY78, we apply promotions on the sequences and synthesised it. Function has not so far been determined , but Deletion analysis indicates that in addition to the core nif genes, hesA plays an important role in nitrogen fixation and is responsive to the availability of molybdenum. HesA a member of the ThiF-MoeB-HesA family and contains an N-terminal nucleotide binding domain and a C-terminal MoeZ/MoeB-like domain. The ThiF-MoeB-HesA family engage in an ATP-dependent process that activates the C-terminus of partner ubiquitin-like proteins by forming an acyl adenylate complex that facilitates sulfur transfer. First, we promoted it ourselves（done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline. Sequence submit is promoted by the synthesis company, containing a PstI in the gene false false _2221_ 23592 23592 9 false We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves（done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But the part can be assembled by gibson assembly,that is what we did. false Nannan Xie annotation2475145 1 unknown rbs range2475145 1 1 21 annotation2473742 1 hesA coding sequence range2473742 1 22 789 BBa_K1796013_sequence 1 gcacatggagggggtggacgaatggtgcaactgctggaagatagccgttacggtcgtcaactgaaactgctgggcgttgaaggtcagaatcgtctgaaacaagccaccgttatggttgcaggtattggcggtctgggcggcgctgcagcaatgtatctggctgctgctggtgttggtaaactgattctggctcacgaaggcgttatccatctgccggatatgaaccgtcaggttctgatggatagcggtcgtattggcgaagaacgtatggaaaccgcactgcaacatctgcatcgcattaacccggaaaccgaactggaaggtcacgcacatcgtattaccgaagaaagctctggtccgtgggttgaagcatctgatatcgtcatcgacgcacgttacgattttccggaacgttacgctctgaatcgtctgtgcgttcgtcacggtcgtccgatgattgaagcagcaatgtacgcgtacgaagtcagcctgatgaccattgatccggggaaaaccgcttgtctggagtgtctgtatccggaaggcggtcaaccgtgggaaccgctgggttttccggtactgggcgcaacctctggtctgattggttgtatggcagcactggaagccgttaaatggattaccgacgcaggtaacctgttcaccgatcgtatgtaccgcatgaacgtcctggatatgagcagctgtaccatcgcagtcaaacgtaatccgcgttgtccgtgttgtggtaccggcggcgataccgacgaaagcgtggcatatctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z