BBa_K1796203 1 BBa_K1796203 An unloaded sgRNA that contains BbsI cutting site, with a promoter and terminator. 2015-09-15T11:00:00Z 2015-09-16T10:21:58Z iGEM This part contains a sgRNA which we designed to be expressed in procaryotic organism. There is a promoter in fron of it and a terminator behind.Instead of a certain crRNA, we designed a BbsI cutting site in the middle of the sgRNA, on the place where the crRNA should be. So we can use this part to knockout any sequence as we want in procaryotic organism by the way of CRISPR. false false _2221_ 23548 23548 9 false According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below: crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2) tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below: sgRNA: ca<aaacgggtcttcgagaagacgt>tttagagcta (part of repeat2) gaaa (a linker between crRNA and tracrRNA) tagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption) To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012. false Yu Luo BBa_K1796203_sequence 1 gaattcgcggccgcttctagagttgacggctagctcagtcctaggtataatgctagccaaaacgggtcttcgagaagacgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttggctcaccttcgggtgggccttttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z